| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| Circ_KCNN2 | |||
| Gene | KCNN2 | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Gliomas | ICD-10 | Malignant neoplasm of Brain, unspecified (C71.9) |
| DBLink | Link to database | PMID | 26873924 |
| Experimental Method | |||
| Sample Type | Tissues | Comparison | 19 fresh-frozen de novo Glioblastoma Multiforme (GBM) and 7 oligodendroglioma |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward ATGGACTGTCCGAGCTTGTG ReverseGTGGTTGTGGATGGGGCATA | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Song, X, Zhang, N, Han, P, Moon, BS, Lai, RK, Wang, K, Lu, W (2016). Circular RNA profile in gliomas revealed by identification tool UROBORUS. Nucleic Acids Res., 44, 9:e87. | |||