| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circANKRD12 | |||
| Gene | ANKRD12 | Organism | Human |
| Genome Locus | Build | hg19 | |
| Disease | Various Cancer Cell Types | ICD-10 | - (-) |
| DBLink | PMID | 31185953 | |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | Ovarian cancer cell lines PA-1 (ATCC CRL-1572), SKOV3(ATCC HTB-77),Caov3(ATCC HTB-75), NIH:OVCAR-3 (ATCC HTB-161), breast cancer cell lines MDA-MB-231(ATCC HTB-26), MCF7(ATCC HTB-22),T-47D (ATCC HTB-133) and breast normal cell line MCF 10A(ATCC CRL-10317), Lung cancer cell lines, HCC2935(ATCC CRL-2869™) and NCI-H226 (ATCC CRL-5826) and Lung Normal Fibroblast cell line LL 24(ATCC CCL-151) (all from American type Cell Collection, Manassas, VA), APOCC (ovarian primary cell line derived from ascites fluid) (pers. communication Dr. Arash Tabrizi), A27809 (93112519-1VL,Sigma), A2780 CIS (93112519-1VL,Sigma) |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TAAACATGGGGAGCGTCCAG ReverseGTGAACCCAGATTTGGGCATT | Statistics | Fold Change : Upregulated pvalue : <0.05 |
| Citation | |||
| Karedath, T, Ahmed, I, Al Ameri, W, Al-Dasim, FM, Andrews, SS, Samuel, S, Al-Azwani, IK, Mohamoud, YA, Rafii, A, Malek, JA (2019). Silencing of ANKRD12 circRNA induces molecular and functional changes associated with invasive phenotypes. BMC Cancer, 19, 1:565. | |||