| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circRNA_100367/hsa_circ_0014879 | |||
| Gene | DCAF8 | Organism | Human |
| Genome Locus | chr1:160206924-160231148:- | Build | hg19 |
| Disease | Esophageal Cancer | ICD-10 | Oesophagus, unspecified (C15.9) |
| DBLink | Link to database | PMID | 27465405 |
| Experimental Method | |||
| Sample Type | KYSE-150 Cell lines | Comparison | 3 samples from human Esophageal Squamous Cancer cell lines KYSE-150 and radioresistant KYSE-150R cell lines |
| Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
| Primers (Experimented) | Forward TCTCCCTGTACGTTCTTATCTGC ReverseCTGCTCCCTTTGCTGGACATC | Statistics | Fold Change : Upregulated,5.62 pvalue : p<0.05 |
| Citation | |||
| Su, H, Lin, F, Deng, X, Shen, L, Fang, Y, Fei, Z, Zhao, L, Zhang, X, Pan, H, Xie, D, Jin, X, Xie, C (2016). Profiling and bioinformatics analyses reveal differential circular RNA expression in radioresistant esophageal cancer cells. J Transl Med, 14, 1:225. | |||