circad | circRNAs associated with diseases
hsa_circ_006100
 GeneOrganismHuman
 Genome LocusBuildhg19
 DiseaseGastric CancerICD-10 Gastric Cancer (C16.9)
 DBLinkLink to databasePMID31318114
 Experimental Method
 Sample TypeTissue and cell linesComparisonTwenty pairs of GC tissue and adjacent non"Étumour tissue
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

ATAACAACTGCTCAGAGTGCGA

Reverse

CTCAGCTTCCTGTAGGATGGTC

StatisticsFold Change : Upregulated
pvalue : <0.05
 Citation
Liang, M, Huang, G, Liu, Z, Wang, Q, Yu, Z, Liu, Z, Lin, H, Li, M, Zhou, X, Zheng, Y (2019). Elevated levels of hsa_circ_006100 in gastric cancer promote cell growth and metastasis via miR-195/GPRC5A signalling. Cell Prolif., 52, 5:e12661.